Cyanobacteria 16s PCR Amplification Kit (Internal qPCR primer set)

$376.25

In Stock & Ready to Ship

  • Foruse as a cyanobacteria internal amplification control
  • Use in combination with Attogene Algae DNA isolation kit
  • Perfect for Environmental DNA (eDNA) Characterization
SKU: NA2030 Categories: , Tags: ,
Share:
Compare

The 16S ribosomal RNA (rRNA) plays a crucial role in bacterial and archaeal ribosomes. Oligonucleotide primers for the specific amplification of 16S rRNA gene segments from cyanobacteria are perfect for use as an internal amplification control with our Microcystin, ATX and AETK and  qPCR kits

Forward primer: 5’- AGCCACACTGGGACTGAGACA -3′ 

Reverse primer set:  5’-TCGCCCATTGCGGAAA -3′ 

Probe 1: 5’-/5SUN CCT ACG GGA /ZEN/ GGC AGC AGT GGG /3IABkFQ-3′

Product size: 73 base pairs. – effective primer set for .cyanobacteria internal amplification control

Primer mix of 10uM – 150ul

PCR water -1mL

You may also like…

Anatoxin qPCR Detection Kit (real-time PCR kit for Anatoxin C gene)

$376.25

This kit is sufficient for 150 reactions:

  • Real time qPCR kit for detection of anatoxin gene cluster
  • Use in combination with Attogene Algae DNA isolation kit
  • Includes a 16S cyanobateria amplification control
  • Two AnaC primer Sets included
  • SYBR Detection

Universal 23s PCR Amplification Kit (For cyanobacteria species identification)

$376.25
  • This kit is sufficient for 150 reactions:
  • For characterizing cyanobacteria in environmental samples
  • Use in combination with Attogene Algae DNA isolation kit
  • Universal 23s PCR primers
  • Perfect for Environmental DNA (eDNA) Characterization

Plant and Algae RNA Isolation Kit

$455.80

This kit is sufficient for 100 RNA isolations based on:

  • 200mg fresh plant
  • 1ml algae culture
  • 50mg dry seeds.

Compatible with automated systems.

Microcystin qPCR Detection Kit (real-time PCR kit for MycE Cluster)

$376.25

This kit is sufficient for 150 reactions:

  • Real time qPCR kit
  • For screening microcystin gene cluster
  • Use in combination with Attogene Algae DNA isolation kit

Compatible with automated systems.