Microcystin qPCR Detection Kit (real-time PCR kit for MycE Cluster)

$376.25

In Stock & Ready to Ship

This kit is sufficient for 150 reactions:

  • Real time qPCR kit
  • For screening microcystin gene cluster
  • Use in combination with Attogene Algae DNA isolation kit

Compatible with automated systems.

SKU: NA2024 Categories: , Tags: ,
Share:
Compare

Attogene’s PCR kit for Microcystin is designed for the In vitro analysis of the MycE region responsible for assembling part of the Microcystis peptide. The MycE gene region specific primer and probe mix is provided to be detected through the FAM channel on a qPCR machine. A sample of algae is obtained and washed to extract a clean algal gDNA sample. A reaction mixture is assembled from primers, probe, master mix, and gDNA samples as required. The qPCR machine of choice is set up and loaded as needed and the mixture undergoes PCR amplification. The Primer mix provided exploits the Taq polymerase to amplify the gene region of interest; while the DNA probe mixture is cleaved during amplification to release its FAM fluorophore. The resulting FAM release can be detected on a variety of qPCR platforms.

 

Forward Primer

5’-CTTACGGAATGCCCAGTGCTTATCAA-3′

Reverse Primer

5’-CATTTGATTATGGACAACTTGACGGG-3′

Probe

5’- 56Fam/TGGCGTTGAATTAACTGTTGAAAGGCA/3IABkFQ-3′

 

You may also like…

Microcystin Detection Kit (Rapid – Recreational Water)

$161.25
  • Screening of Microcystins in water samples at 6 ppb or lower
  • Format: 10 tests (5 tests/5 control)
  • Water Sample Bottles
  • Negative Control
  • 1mL Syringe
  • Sample Dilution Buffer also sold separately
  • Sample Filters

Plant and Algae RNA Isolation Kit

$455.80

This kit is sufficient for 100 RNA isolations based on:

  • 200mg fresh plant
  • 1ml algae culture
  • 50mg dry seeds.

Compatible with automated systems.

Microcystin ELISA Kit

$446.12
  • Format: 96-well microtiter plate (12 test strips of 8 wells)
  • Standards: 0 | 0.05 | 0.1 | 0.2 | 0.4 | 2 ppb
  • Incubation Time: 75 Minutes

Anatoxin qPCR Detection Kit (real-time PCR kit for Anatoxin C gene)

$376.25

This kit is sufficient for 150 reactions:

  • Real time qPCR kit for detection of anatoxin gene cluster
  • Use in combination with Attogene Algae DNA isolation kit
  • Includes a 16S cyanobateria amplification control
  • Two AnaC primer Sets included
  • SYBR Detection

Universal 16s PCR Amplification Kit (For cyanobacteria species identification)

$376.25
  • For Species identification of cyanobacteria in environmental samples
  • Use in combination with Attogene Algae DNA isolation kit
  • Perfect for Environmental DNA (eDNA) Characterization